DKK-SP1 is one of the many neurotoxins present in the scorpion Mesobuthus martensii. This toxin inhibits the voltage-gated sodium channel Nav1.8.
Sources
editDKK-SP1 is a neurotoxin, which is named after the DKK-SP1 gene that is extracted from a cDNA library of Mesobuthus martensii.[1] DKK-SP1 naturally occurs in the venom gland located in its stinger (or telson). This scorpion is also known as the Golden Chinese Scorpion or the Manchurian scorpion. It was formerly called Buthus martensii Karsch (BmK).
Chemistry
editFamily
editDKK-SP1 is part of the alpha-like toxin family of scorpion toxins, which typically consist of 60 to 76 amino acid residues.[1] DKK-SP1 specifically is composed of 66 amino acid residues folded into beta sheets with an alpha helix atop. The structures of these alpha-like toxins are linked together by four disulfide bonds.[2]
Structure
edit
The molecular mass of the peptide chain of the toxin is 7157.96 Da. Its gene sequence is as follows:
GTTCGTGATGCTTATATTGCCAAGCCCGAAAACTGTGTATACCATTGTGCTACAAATGAAGGTTGCAACAAATTATGTACTGACAATGGTGCTGAGAGTGGCTATTGCC AATGGGGAGGTAGATATGGAAATGCCTGCTGGTGCATAAAGTTGCCCGATAGTGTACCGATTGAAGTACCAGGAAAATGCCAACGCTAA
As a result, the amino acid sequence is:
Val-Arg-Asp-Ala-Tyr-Ile-Ala-Lys-Pro-Glu-Asn-Cys-Val-Tyr-His-Cys-Ala-Thr-Asn-Glu-Gly-Cys-Asn-Lys-Leu-Cys-Thr-Asp-Asn-Gly-Ala-Glu-Ser-Gly-Tyr-Cys-Gln-Trp-Gly-Gly-Arg-Tyr-Gly-Asn-Ala-Cys-Trp-Cys-Ile-Lys-Leu-Pro-Asp-Ser-Val-Pro-Ile-Glu-Val-Pro-Gly-Lys-Cys-Gln-Arg
Homology
editDKK-SP1 shares 92.19% of its amino acid sequence with BmK M4,[1] which also is a scorpion alpha-like toxin. DKK-SP1 is also functionally similar to delta-conotoxins, which binds to the receptor site 6 of voltage-gated sodium channel, slowing the channel’s inactivation state.
Target
editDKK-SP1 specifically targets site 3 of the voltage-gated sodium channel, Nav1.8.[1]
Mode of Action
editThe alpha-like toxin family of scorpion toxins occupies the receptor site 3 of voltage-gated sodium channels. Receptor site 3 is located between segments 3 and 4 of the alpha subunit of the voltage-gated sodium channel. Mechanically, alpha-like scorpion toxins prevent the normal gating movement of the sodium channel S4 segment by changing its conformational properties. This leads to delayed channel inactivation, which prolongs the depolarization phase of the action potential.[2]
Toxicity
editGenerally, Mesobuthus martensii is not considered as highly lethal to humans.[1] Scorpion injuries usually cause skin redness, swelling, and numbness.[3] The Buthus scorpion may also provoke symptoms of severe excitation of the Autonomic Nervous System.[4] Goudet, et al. showed that the LD50 of Mesobuthus martensii toxins is 2.4 mg/kg in humans. The LD50 of DKK-Sp1 in mice is 20.57 grams/kg.[1]
Treatment
editAlthough Mesobuthus martensii is not considered as a particularly lethal scorpion, its injuries may still cause local symptoms. Treatment against such effects is mostly symptomatic.[4] Moderate and severe cases may require hospitalization.[4]
A 2002 clinical study conducted by Liu et al concluded that DKK-SP1 exhibited anti-inflammatory properties in mice. Mesobuthus martensii toxins have been used in Chinese medicine for years.[1] However, no clinical trials have been performed on humans yet.
References
edit- ^ a b c d e f g Liu, Yunxia; Li, Yan; Zhu, Yuchen; Zhang, Liping; Ji, Junyu; Gui, Mingze; Li, Chunli; Song, Yongbo (July 21, 2021). "Study of Anti-Inflammatory and Analgesic Activity of Scorpion Toxins DKK-SP1/2 from Scorpion Buthus martensii Karsch (BmK)". Toxins. 13 (7): 498. doi:10.3390/toxins13070498. PMC 8310270. PMID 34357970.
- ^ a b Goudet, Cyril; Chi, Cheng-Wu; Tytgat, Jan (September 21, 2002). "An overview of toxins and genes from the venom of the Asian scorpion Buthus martensi Karsch". Toxicon. 40 (9): 1239–1258. doi:10.1016/s0041-0101(02)00142-3. PMID 12220709 – via PubMed.
- ^ Chippaux, Jean-Philippe (October 21, 2012). "Emerging options for the management of scorpion stings". Drug Design, Development and Therapy. 6: 165–173. doi:10.2147/DDDT.S24754. PMC 3401053. PMID 22826633.
- ^ a b c Isbister, Geoffrey K.; Bawaskar, Himmatrao Saluba (July 31, 2014). "Scorpion envenomation". The New England Journal of Medicine. 371 (5): 457–463. doi:10.1056/NEJMra1401108. PMID 25075837 – via PubMed.